In this topic I´ll give you 5 ways of DNA analysis but first let´s see what is this...
is an examination method that emerged in the 1980s and is credited to Alec Jeffreys, an English geneticist. Every species has unique genetic sequences. DNA analysis allows any type of organism to be identified by analyzing its genetic sequences. This method can also clarify questions of identification within a species.
Identification within a species can present more of a challenge than determining between two different species. For example, it is much easier to determine whether a victim was attacked by a bear or human than it is to determine which human perpetrated an attack. DNA analysis is usually performed by forensic scientists. In instances where individuals need to be identified, the forensic scientists tend to employ a method of scanning 13 regions of the human genome.
is an examination method that emerged in the 1980s and is credited to Alec Jeffreys, an English geneticist. Every species has unique genetic sequences. DNA analysis allows any type of organism to be identified by analyzing its genetic sequences. This method can also clarify questions of identification within a species.
Identification within a species can present more of a challenge than determining between two different species. For example, it is much easier to determine whether a victim was attacked by a bear or human than it is to determine which human perpetrated an attack. DNA analysis is usually performed by forensic scientists. In instances where individuals need to be identified, the forensic scientists tend to employ a method of scanning 13 regions of the human genome.
This are the 5 ways of analysis that we will check this time
DNA profiling
DNA forensics
Paternity test
Polimerase chain reactor (PCR)
Sanger method
DNA profiling
Each of us has a unique DNA profile or fingerprint. A technique called electrophoresis is used to obtain DNA profiles, relying on sections of our DNA that are known as non-coding DNA (DNA that does not code for a protein).
We have many sections of non-coding DNA in our genome. Within this non-coding DNA are areas called short tandem repeats (STRs). For example, you may have a stretch of DNA made up of the following base sequence:
ATCTTCTAACACATGACCGATCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGTTCCATGATAGCACAT
This sequence starts off looking random, but then has repeats of the sequence CATG towards the middle. It becomes random again near the end. The repetitive section of the sequence is what is referred to as an STR.
For a given STR, you will have inherited different numbers of the repeated sequence from each of your parents. For example, you may have inherited 11 repeats of the CATG sequence, as shown above, on a chromosome from your mother, and 3 repeats of this sequence within the STR on the matching chromosome from your father.
The different numbers of repeats within an STR results in DNA of different lengths. Because of this, electrophoresis can be used to show how many repeats you have.
DNA forensics
To identify individuals, forensic scientists scan 13 DNA regions, or loci, that vary from person to person and use the data to create a DNA profile of that individual (sometimes called a DNA fingerprint). There is an extremely small chance that another person has the same DNA profile for a particular set of 13 regions.
Some Examples of DNA Uses for Forensic Identification
- Identify potential suspects whose DNA may match evidence left at crime scenes
- Exonerate persons wrongly accused of crimes
- Identify crime and catastrophe victims
- Establish paternity and other family relationships
- Identify endangered and protected species as an aid to wildlife officials (could be used for prosecuting poachers)
- Detect bacteria and other organisms that may pollute air, water, soil, and food
- Match organ donors with recipients in transplant programs
- Determine pedigree for seed or livestock breeds
- Authenticate consumables such as caviar and wine
Paternity Test
Parental testing is the use of genetic fingerprinting to determine whether two individuals have a biological parent-child relationship. A paternity test establishes genetic proof whether a man is the biological father of an individual, and a maternity test establishes whether a woman is the biological mother of an individual. Though genetic testing is the most reliable standard, older methods also exist including ABO blood group typing, analysis of various other proteins and enzymes, or using human leukocyte antigen antigens. The current techniques for paternal testing are using polymerase chain reaction (PCR) and restriction fragment length polymorphism.
DNA testing is currently the most advanced and accurate technology to determine parentage. In a DNA parentage test, the probability of parentage is 0% when the alleged parent is not biologically related to the child and the probability of paternity typically greater than 99.9% when the alleged parent is biologically related to the child.
PCR
The polymerase chain reaction (PCR) is a scientific technique in molecular biology to amplify a single or few copies of a piece of DNA across several orders of magnitude, generating thousands to millions of copies of a particular DNA sequence. The method relies on thermal cycling, consisting of cycles of repeated heating and cooling of the reaction for DNA melting and enzymatic replication of the DNA. Primers (short DNA fragments) containing sequences complementary to the target region along with a DNA polymerase (after which the method is named) are key components to enable selective and repeated amplification. As PCR progresses, the DNA generated is itself used as a template for replication, setting in motion a chain reaction in which the DNA template is exponentially amplified. PCR can be extensively modified to perform a wide array of genetic manipulations.
Almost all PCR applications employ a heat-stable DNA polymerase, such as Taq polymerase, an enzyme originally isolated from the bacterium Thermus aquaticus. This DNA polymerase enzymatically assembles a new DNA strand from DNA building blocks, the nucleotides, by using single-stranded DNA as a template and DNA oligonucleotides (also called DNA primers), which are required for initiation of DNA synthesis. The vast majority of PCR methods use thermal cycling, i.e., alternately heating and cooling the PCR sample to a defined series of temperature steps. These thermal cycling steps are necessary first to physically separate the two strands in a DNA double helix at a high temperature in a process called DNA melting. At a lower temperature, each strand is then used as the template in DNA synthesis by the DNA polymerase to selectively amplify the target DNA. The selectivity of PCR results from the use of primers that are complementary to the DNA region targeted for amplification under specific thermal cycling conditions.
Sanger method
